Despite its slightly toy-like looks, the MPC Sample is a fast and fun machine that channels the spirit of its early-'90s predecessors. Fun, fast workflow reminiscent of classic MPCs. Chopping and ...
1. Cut beef steak lengthwise in half then crosswise into 1/8 to 1/4-inch thick strips. 2. Combine marinade ingredients in a medium bowl. Add beef and toss to coat. Cover and marinate in the ...
Today, March 20, marks the beginning of the Spring Equinox which is the perfect time to shift your attention to your garden and get it ready for the new season. If you don't know where to start but ...
A Virginia murder case is fueling a political fight over immigration enforcement, as the victim’s family and Republican officials blame Democratic Gov. Abigail Spanberger’s policies and a progressive ...
Look to the west after sunset this week for a spectacular sight, as the razor-thin waxing crescent moon hangs low above the horizon with earthshine bathing its unlit surface in a soft, otherworldly ...
Local immigration attorney Esther Valdes Clayton joined “Good Morning San Diego” Monday to discuss President Donald Trump’s plan to add ICE agents at 14 airports around the country. The objective is ...
We carried out primer extension using total RNA prepared from NHK with primer 5′–ACAGTTTTGTGAGCCACCGTGTGGTTG–3′ for B2 or primer 5′–AGCAGGCTCTTTCGATCCCCAAGC–3′ for β-galactosidase as described 7. In ...